ID: 1021827445_1021827452

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1021827445 1021827452
Species Human (GRCh38) Human (GRCh38)
Location 7:24569760-24569782 7:24569787-24569809
Sequence CCAGCGGTTTGTAAACCAGTGCC GGGATGCTCAGAGCTGGGAACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 50, 4: 466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!