ID: 1021884984_1021884994

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1021884984 1021884994
Species Human (GRCh38) Human (GRCh38)
Location 7:25129436-25129458 7:25129482-25129504
Sequence CCTGCAATCACTGCCCTGTCCCT TGCCATGTGGCCACTGCTGGGGG
Strand - +
Off-target summary No data {0: 7, 1: 10, 2: 27, 3: 68, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!