ID: 1021986332_1021986339

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1021986332 1021986339
Species Human (GRCh38) Human (GRCh38)
Location 7:26101567-26101589 7:26101608-26101630
Sequence CCGAGGGTAGGCAGGGGCCACCA GTTTCAGGAAGTACGATAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!