ID: 1021986334_1021986341

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1021986334 1021986341
Species Human (GRCh38) Human (GRCh38)
Location 7:26101587-26101609 7:26101615-26101637
Sequence CCAGTCTGCGTGACCCCTGCAGT GAAGTACGATAGCAGGAAACGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 3, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!