ID: 1022009556_1022009558

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1022009556 1022009558
Species Human (GRCh38) Human (GRCh38)
Location 7:26297024-26297046 7:26297068-26297090
Sequence CCATTTAAAGATTAAATGTCAAA ATATATGTAAATATAGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 68, 4: 626} {0: 1, 1: 0, 2: 13, 3: 147, 4: 1443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!