ID: 1022009557_1022009558

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1022009557 1022009558
Species Human (GRCh38) Human (GRCh38)
Location 7:26297048-26297070 7:26297068-26297090
Sequence CCAAAATTATAAATATTAAAATA ATATATGTAAATATAGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 22, 3: 308, 4: 2624} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!