ID: 1022196413_1022196424

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1022196413 1022196424
Species Human (GRCh38) Human (GRCh38)
Location 7:28071617-28071639 7:28071666-28071688
Sequence CCATTTGCCACCCACATACAGAC CGGCACTTACAGCTGATTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 226} {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!