ID: 1022196419_1022196427

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1022196419 1022196427
Species Human (GRCh38) Human (GRCh38)
Location 7:28071639-28071661 7:28071675-28071697
Sequence CCCAAGGACGGACCTTCTATCCA CAGCTGATTAAAGGGTTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 55} {0: 1, 1: 0, 2: 0, 3: 17, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!