ID: 1022196422_1022196426

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1022196422 1022196426
Species Human (GRCh38) Human (GRCh38)
Location 7:28071651-28071673 7:28071672-28071694
Sequence CCTTCTATCCAGTGACGGCACTT TTACAGCTGATTAAAGGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67} {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!