ID: 1022282773_1022282778

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1022282773 1022282778
Species Human (GRCh38) Human (GRCh38)
Location 7:28927606-28927628 7:28927626-28927648
Sequence CCTTGTCTGGAGAGATTTGTGTT GTTTGTCACAGCTTGGGGGATGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 16, 3: 71, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!