ID: 1022411448_1022411451

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1022411448 1022411451
Species Human (GRCh38) Human (GRCh38)
Location 7:30141599-30141621 7:30141624-30141646
Sequence CCGTAACCTCAAATTCCTGGGCT AGCAGCCTGCTGCTTCATCCTGG
Strand - +
Off-target summary {0: 5, 1: 45, 2: 171, 3: 562, 4: 1532} {0: 1, 1: 0, 2: 2, 3: 18, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!