ID: 1022411449_1022411451

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1022411449 1022411451
Species Human (GRCh38) Human (GRCh38)
Location 7:30141605-30141627 7:30141624-30141646
Sequence CCTCAAATTCCTGGGCTGAAGCA AGCAGCCTGCTGCTTCATCCTGG
Strand - +
Off-target summary {0: 8, 1: 341, 2: 3057, 3: 9484, 4: 22018} {0: 1, 1: 0, 2: 2, 3: 18, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!