ID: 1022411450_1022411453

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1022411450 1022411453
Species Human (GRCh38) Human (GRCh38)
Location 7:30141614-30141636 7:30141636-30141658
Sequence CCTGGGCTGAAGCAGCCTGCTGC CTTCATCCTGGCAAGTAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 87, 4: 680} {0: 1, 1: 1, 2: 2, 3: 310, 4: 9625}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!