ID: 1022457382_1022457383

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1022457382 1022457383
Species Human (GRCh38) Human (GRCh38)
Location 7:30569988-30570010 7:30570002-30570024
Sequence CCTATGATAGATTTCTATAATTT CTATAATTTTATGTTTGATTTGG
Strand - +
Off-target summary No data {0: 15, 1: 32, 2: 36, 3: 81, 4: 566}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!