ID: 1022482062_1022482065

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1022482062 1022482065
Species Human (GRCh38) Human (GRCh38)
Location 7:30750842-30750864 7:30750881-30750903
Sequence CCACAATTATACAAGCCAATTAC TCTCTCAGTGTACACAAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 288} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!