ID: 1022499981_1022499990

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1022499981 1022499990
Species Human (GRCh38) Human (GRCh38)
Location 7:30876764-30876786 7:30876779-30876801
Sequence CCACCCCCTGCAAAGATTCTTGG ATTCTTGGAGGGTCCGGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 160} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!