ID: 1022527334_1022527340

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1022527334 1022527340
Species Human (GRCh38) Human (GRCh38)
Location 7:31046818-31046840 7:31046852-31046874
Sequence CCGAGTCAGGGCTCAGGCTGTCA TTATCCTGAGCTGCTTTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 197} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!