ID: 1022529303_1022529319

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1022529303 1022529319
Species Human (GRCh38) Human (GRCh38)
Location 7:31057226-31057248 7:31057278-31057300
Sequence CCGCATTTATCTTCTGCCTTCTT GTGCACTCCCTGACTCCTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!