ID: 1022570999_1022571005

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1022570999 1022571005
Species Human (GRCh38) Human (GRCh38)
Location 7:31454259-31454281 7:31454275-31454297
Sequence CCCCAGCCAGCAGCCATGCCTAA TGCCTAAACCAGCCTGATATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 211} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!