ID: 1022634497_1022634499

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1022634497 1022634499
Species Human (GRCh38) Human (GRCh38)
Location 7:32119304-32119326 7:32119322-32119344
Sequence CCAAGGTCTTAACTACAACTCCA CTCCAGGCTTGCCTCACTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 125} {0: 1, 1: 0, 2: 2, 3: 26, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!