ID: 1022634497_1022634506

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1022634497 1022634506
Species Human (GRCh38) Human (GRCh38)
Location 7:32119304-32119326 7:32119347-32119369
Sequence CCAAGGTCTTAACTACAACTCCA CCTGTTGGTAGCTGCCAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 125} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!