ID: 1022793616_1022793619

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1022793616 1022793619
Species Human (GRCh38) Human (GRCh38)
Location 7:33714378-33714400 7:33714393-33714415
Sequence CCAGGCTCTTTCTGCTGCAGCCC TGCAGCCCTAGCACTGGGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 38, 4: 451}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!