ID: 1022842171_1022842178

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1022842171 1022842178
Species Human (GRCh38) Human (GRCh38)
Location 7:34175158-34175180 7:34175210-34175232
Sequence CCCAGCCTCGCTGCCGCCTTGCA CAGCGAGACACCGTGGGCGTAGG
Strand - +
Off-target summary {0: 1085, 1: 2164, 2: 1733, 3: 667, 4: 510} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!