ID: 1022842172_1022842178

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1022842172 1022842178
Species Human (GRCh38) Human (GRCh38)
Location 7:34175159-34175181 7:34175210-34175232
Sequence CCAGCCTCGCTGCCGCCTTGCAG CAGCGAGACACCGTGGGCGTAGG
Strand - +
Off-target summary {0: 1065, 1: 2097, 2: 1670, 3: 692, 4: 624} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!