ID: 1022842173_1022842178

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1022842173 1022842178
Species Human (GRCh38) Human (GRCh38)
Location 7:34175163-34175185 7:34175210-34175232
Sequence CCTCGCTGCCGCCTTGCAGTGTG CAGCGAGACACCGTGGGCGTAGG
Strand - +
Off-target summary {0: 5, 1: 1087, 2: 2036, 3: 1634, 4: 944} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!