ID: 1022842174_1022842178

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1022842174 1022842178
Species Human (GRCh38) Human (GRCh38)
Location 7:34175171-34175193 7:34175210-34175232
Sequence CCGCCTTGCAGTGTGATCTCAGA CAGCGAGACACCGTGGGCGTAGG
Strand - +
Off-target summary {0: 8, 1: 2877, 2: 1001, 3: 473, 4: 522} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!