ID: 1022842175_1022842176

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1022842175 1022842176
Species Human (GRCh38) Human (GRCh38)
Location 7:34175174-34175196 7:34175203-34175225
Sequence CCTTGCAGTGTGATCTCAGACTG TAGCAATCAGCGAGACACCGTGG
Strand - +
Off-target summary {0: 10, 1: 3679, 2: 1433, 3: 764, 4: 724} {0: 5, 1: 920, 2: 1493, 3: 979, 4: 978}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!