ID: 1022842175_1022842178

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1022842175 1022842178
Species Human (GRCh38) Human (GRCh38)
Location 7:34175174-34175196 7:34175210-34175232
Sequence CCTTGCAGTGTGATCTCAGACTG CAGCGAGACACCGTGGGCGTAGG
Strand - +
Off-target summary {0: 10, 1: 3679, 2: 1433, 3: 764, 4: 724} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!