ID: 1023265268_1023265275

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1023265268 1023265275
Species Human (GRCh38) Human (GRCh38)
Location 7:38398534-38398556 7:38398551-38398573
Sequence CCAGAGGCTGGGAAGGGTAGTGA TAGTGAGGAAGTAGGGGGGATGG
Strand - +
Off-target summary {0: 57, 1: 516, 2: 1053, 3: 1544, 4: 1786} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!