ID: 1023271693_1023271695

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1023271693 1023271695
Species Human (GRCh38) Human (GRCh38)
Location 7:38470029-38470051 7:38470045-38470067
Sequence CCTTGATCAGGTTGAACATCCTG CATCCTGCTTTATCAAGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!