ID: 1023629108_1023629113

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1023629108 1023629113
Species Human (GRCh38) Human (GRCh38)
Location 7:42145912-42145934 7:42145964-42145986
Sequence CCACAGTGAGGAAAGGATTCCTA CAGCTAGCAAGTGACAAAGCTGG
Strand - +
Off-target summary No data {0: 2, 1: 10, 2: 73, 3: 390, 4: 1482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!