ID: 1023747413_1023747419

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1023747413 1023747419
Species Human (GRCh38) Human (GRCh38)
Location 7:43334062-43334084 7:43334113-43334135
Sequence CCTATTGAGTGTTTCAGCCAAGT TTGGTGAGGACAGAGATCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!