ID: 1023747415_1023747419

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1023747415 1023747419
Species Human (GRCh38) Human (GRCh38)
Location 7:43334079-43334101 7:43334113-43334135
Sequence CCAAGTCAATGGTTGTGCATAGC TTGGTGAGGACAGAGATCTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!