ID: 1023855064_1023855071 |
View in Genome Browser |
Spacer: 5 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1023855064 | 1023855071 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:44177908-44177930 | 7:44177936-44177958 |
Sequence | CCTAACACAGTATACCAGGGGTG | AGAAATCAGCCTATGAGGGCGGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 80} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |