ID: 1023885160_1023885169

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1023885160 1023885169
Species Human (GRCh38) Human (GRCh38)
Location 7:44349054-44349076 7:44349094-44349116
Sequence CCCCAGAGACATAAGGGTGTTCA AGCCCACCTCAGCCAGTTCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!