ID: 1023906222_1023906227

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1023906222 1023906227
Species Human (GRCh38) Human (GRCh38)
Location 7:44523482-44523504 7:44523526-44523548
Sequence CCACTCCCAGCCTCAAGGCATGC GCAGCTTGTACACAGCTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 54, 4: 560} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!