ID: 1023906470_1023906474

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1023906470 1023906474
Species Human (GRCh38) Human (GRCh38)
Location 7:44525799-44525821 7:44525836-44525858
Sequence CCTCAAAAAGATTATCAGCATAT CTTGAAGCCCAGATGGCAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 42, 4: 365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!