ID: 1024023606_1024023609

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1024023606 1024023609
Species Human (GRCh38) Human (GRCh38)
Location 7:45392165-45392187 7:45392193-45392215
Sequence CCACTGCCTGGCTCAGCAGCTGC AAACTGCCAGAGTCACAGATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 161, 4: 781} {0: 1, 1: 0, 2: 1, 3: 10, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!