ID: 1024104145_1024104147

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1024104145 1024104147
Species Human (GRCh38) Human (GRCh38)
Location 7:46064742-46064764 7:46064768-46064790
Sequence CCAGATTCTAGCAGTGAATCTGA AAAGGCTTAGTGAAGTCTCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!