ID: 1024242790_1024242793

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1024242790 1024242793
Species Human (GRCh38) Human (GRCh38)
Location 7:47448284-47448306 7:47448303-47448325
Sequence CCCTCTGCAACAAAACTTCCTTG CTTGAAGTCCACGACGTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 235} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!