ID: 1024251904_1024251910

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1024251904 1024251910
Species Human (GRCh38) Human (GRCh38)
Location 7:47511966-47511988 7:47511990-47512012
Sequence CCATGTACTTTAGACGCCTTGTT CACCTGTTCCCATGGGGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68} {0: 1, 1: 0, 2: 1, 3: 22, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!