ID: 1024298931_1024298944

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1024298931 1024298944
Species Human (GRCh38) Human (GRCh38)
Location 7:47870805-47870827 7:47870858-47870880
Sequence CCTGGGCAACATGATGAAATTAG AGCTACTTGGGAGGCGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 37, 3: 547, 4: 7020} {0: 71, 1: 13183, 2: 28631, 3: 47579, 4: 211466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!