ID: 1024518788_1024518793

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1024518788 1024518793
Species Human (GRCh38) Human (GRCh38)
Location 7:50284591-50284613 7:50284619-50284641
Sequence CCATTCCCACTATGCTGCTGGCC AAAGCATGAGCCAGTCAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 213} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!