ID: 1024563490_1024563494

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1024563490 1024563494
Species Human (GRCh38) Human (GRCh38)
Location 7:50663421-50663443 7:50663439-50663461
Sequence CCTCCTGCCACAGCCTCTCACCA CACCATCGAGTCCCTCCACTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 28, 3: 438, 4: 6434} {0: 1, 1: 0, 2: 1, 3: 7, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!