ID: 1024602873_1024602876

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1024602873 1024602876
Species Human (GRCh38) Human (GRCh38)
Location 7:51000289-51000311 7:51000326-51000348
Sequence CCCTCTACAGAGCTCTGGTTTTC TCCTTCCCTTCTGTTCTCCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!