ID: 1024829368_1024829372

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1024829368 1024829372
Species Human (GRCh38) Human (GRCh38)
Location 7:53431005-53431027 7:53431040-53431062
Sequence CCAAGTAACTCAGGAATGGAAAA TGTTCTCACATAAAAGTGGGAGG
Strand - +
Off-target summary {0: 4, 1: 3, 2: 7, 3: 34, 4: 375} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!