ID: 1025048379_1025048387

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1025048379 1025048387
Species Human (GRCh38) Human (GRCh38)
Location 7:55712612-55712634 7:55712653-55712675
Sequence CCGGTCTTCAGAATTCCAAATAT AATGAAGCACTGAATTGGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 259} {0: 2, 1: 0, 2: 2, 3: 12, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!