ID: 1025061525_1025061536

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1025061525 1025061536
Species Human (GRCh38) Human (GRCh38)
Location 7:55812799-55812821 7:55812848-55812870
Sequence CCCCCAGCAGCACCATACTAAAC AGGGAGAGTGAAGTGATTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 125} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!