ID: 1025157643_1025157647

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1025157643 1025157647
Species Human (GRCh38) Human (GRCh38)
Location 7:56623741-56623763 7:56623776-56623798
Sequence CCTTTAAGGAGTCAATCTCAACT AAGCACCCCTTGGGAAAAACTGG
Strand - +
Off-target summary {0: 18, 1: 22, 2: 57, 3: 74, 4: 333} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!