ID: 1025251965_1025251972

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1025251965 1025251972
Species Human (GRCh38) Human (GRCh38)
Location 7:57357454-57357476 7:57357483-57357505
Sequence CCAGGCACTGGGCAAGGCTCTGG GGTGAAGTTCCCGCTTTCGTAGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 39, 3: 251, 4: 1361} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!